## Warning: package 'dplyr' was built under R version 3.5.1

CRI RNAseq Pipelines

RUN AS PRACTICE

This tutorial of RNA-seq analysis pipeline is all designed based on the HPC environment in CRI. Any changes on the meta data file (i.e., example/DLBC/DLBC.metadata.txt) will be considered as not running for practice and should expect the results not be the same as shown here.

Pipeline package is available on GitHub

The Center for Research Informatics (CRI) provides computational resources and expertise in biomedical informatics for researchers in the Biological Sciences Division (BSD) of the University of Chicago.

As a bioinformatics core, we are actively improving our pipelines and expanding pipeline functions. The tutorials will be updated in a timely manner but may not reflect the newest updates of the pipelines. Stay tuned with us for the latest pipeline release.

If you have any questions, comments, or suggestions, feel free to contact our core at bioinformatics@bsd.uchicago.edu or one of our bioinformaticians.

Introduction | Top

RNA sequencing (RNA-seq) is a revolutionary approach that uses the next-generation sequencing technologies to detect and quantify expressed transcripts in biological samples. Compared to other methods such as microarrays, RNA-seq provides more unbiased assessment of the full range of transcripts and their isoforms with greater dynamic range in expression quantification.

In this tutorial, you will learn how to use the CRI’s RNA-seq pipeline (available on both CRI HPC cluster and GitHub)) to analyze Illumina RNA sequencing data. The tutorial comprises the following Steps:

By the end of this tutorial, you will:

This tutorial is based on CRI’s high-performance computing (HPC) cluster. If you are not familiar with this newly assembled cluster, a concise user’s guide can be found here.

Work Folow | Top

The RNA-seq data used in this tutorial are from a published paper that explores PRDM11 and lymphomagenesis. We will use the data from the PRDM11 knockdown and wildtype samples. You are welcome to explore the full dataset on GEO (GSE56065).

In this tutorial, we use a subset of the data focusing on chr11 in human as the example data set. The sample information are saved in the file DLBC.metadata.txt (see below).

Work Flow

Work Flow

Data Description | Top

There are six (partical) single-end RNA-seq seuqnecing libraries will be used as the example data set In this tutorial. Their respective sample information is described in the meta data table example/DLBC.metadata.txt.

Sample Description
Sample Library ReadGroup LibType Platform SequencingCenter Date Lane Unit Flavor Encoding Run Genome NucleicAcid Group Location Seqfile1
KO01 KO01 SRR1205282 NS Illumina SRA 2015-07-22 7 FCC2B5CACXX 1x49 33 0 grch38 rnaseq KO /group/bioinformatics/CRI_RNAseq_2018/example/data KO01.test.fastq.gz
KO02 KO02 SRR1205283 NS Illumina SRA 2015-07-22 7 FCC2B5CACXX 1x49 33 0 grch38 rnaseq KO /group/bioinformatics/CRI_RNAseq_2018/example/data KO02.test.fastq.gz
KO03 KO03 SRR1205284 NS Illumina SRA 2015-07-22 7 FCC2B5CACXX 1x49 33 0 grch38 rnaseq KO /group/bioinformatics/CRI_RNAseq_2018/example/data KO03.test.fastq.gz
WT01 WT01 SRR1205285 NS Illumina SRA 2015-07-22 4 FCC2C3CACXX 1x49 33 0 grch38 rnaseq WT /group/bioinformatics/CRI_RNAseq_2018/example/data WT01.test.fastq.gz
WT02 WT02 SRR1205286 NS Illumina SRA 2015-07-22 4 FCC2C3CACXX 1x49 33 0 grch38 rnaseq WT /group/bioinformatics/CRI_RNAseq_2018/example/data WT02.test.fastq.gz
WT03 WT03 SRR1205287 NS Illumina SRA 2015-07-22 4 FCC2C3CACXX 1x49 33 0 grch38 rnaseq WT /group/bioinformatics/CRI_RNAseq_2018/example/data WT03.test.fastq.gz

Note

Column LibType can be “NS” for unstranded, “RF” for first strand, or “FR” for second strand.

You can read this blog for more details of strand-specific RNA-seq.

For the persepctive of running as practice, here we use a subset of the human genome GRCh38.primary_Gencode24_50bp_chr11 for Steps 1~4, and the complete information for Step 5

Prerequisites | Top

We will use SSH (Secure Shell) to connect to CRI’s HPC. SSH now is included or can be installed in all standard operating systems (Windows, Linux, and OS X).

Login and Setup Tutorial Working Directory | Top

The login procedure varies slightly depending on whether you use a Mac/Unix/Linux computer or a Windows computer.

  • Log into one of entry nodes in CRI HPC
    1. Open a terminal session.
    2. Connect to the login node of the CRI HPC cluster:

      $ ssh -l username@gardner.cri.uchicago.edu
    3. If it’s your first time to log in, you will be asked to accept the ssh key. Type “yes
    4. Type in the password when prompted

      Make sure that you replace username with your login name.

  • Set up tutorial directory
    1. Now you should be in your home directory after logging in

      $ pwd
      /home/username
    2. Create a new directory (e.g., cri_rnaseq) under the home directory

      $ mkdir cri_rnaseq
      $ cd cri_rnaseq
  • Download the pipeline package
    1. One way to download the pipeline package via git clone

      $ git clone git://github.com/wenching/cri_rnaseq_2018.git
    2. Or, you can use wget to download the pipeline package

      $ wget https://github.com/wenching/cri_rnaseq_2018/archive/master.zip
      $ unzip master.zip
      $ mv cri_rnaseq_2018-master cri_rnaseq_2018
    3. Change working directory to pipeline dirctory

      $ cd cri_rnaseq_2018
      $ tree -d
      |-- SRC
      |   |-- Python
      |   |   |-- lib
      |   |   |-- module
      |   |   `-- util
      |   `-- R
      |       |-- module
      |       `-- util
      |-- example
      |   |-- DLBC_full
      |   |   `-- RNAseq
      |   |       |-- DEG
      |   |       |   |-- deseq2
      |   |       |   |   `-- featurecounts
      |   |       |   |       `-- star
      |   |       |   |-- edger
      |   |       |   |   `-- featurecounts
      |   |       |   |       `-- star
      |   |       |   `-- limma
      |   |       |       `-- featurecounts
      |   |       |           `-- star
      |   `-- data
      `-- references
          `-- GRCh38.primary_Gencode24_50bp_chr11
  • File structure
    • Raw seqencing data files (*.fastq.gz) are located at example/data/

      $ tree example/data/
      |-- KO01.test.fastq.gz
      |-- KO02.test.fastq.gz
      |-- KO03.test.fastq.gz
      |-- WT01.test.fastq.gz
      |-- WT02.test.fastq.gz
      |-- WT03.test.fastq.gz
    • Genome data are located at /group/bioinformatics/Workshops/cri2016/reference/rnaseq/GRCh38.primary_Gencode24_50bp_chr11

      $ tree /group/bioinformatics/Workshops/cri2016/reference/rnaseq/GRCh38.primary_Gencode24_50bp_chr11
      |-- GRCh38.primary_assembly.genome.chr11.chrom.size
      |-- GRCh38.primary_assembly.genome.chr11.dict
      |-- GRCh38.primary_assembly.genome.chr11.fa
      |-- GRCh38.primary_assembly.genome.chr11.fa.fai
      |-- gencode.v24.primary_assembly.annotation.chr11.bed12
      |-- gencode.v24.primary_assembly.annotation.chr11.gtf
      |-- gencode.v24.primary_assembly.annotation.chr11.gtf.geneinfo
      |-- gencode.v24.primary_assembly.annotation.chr11.gtf.transcriptinfo
      |-- gencode.v24.primary_assembly.annotation.chr11.rRNA.bed
      |-- gencode.v24.primary_assembly.annotation.chr11.rRNA.interval_list
      |-- gencode.v24.primary_assembly.annotation.chr11.refFlat.txt
    • project related files (i.e., meta data & configuration file) are located at example/

      $ ls -l example/DLBC.*
      |-- DLBC.metadata.txt
      |-- DLBC.pipeline.yaml
      • Here are the first few lines in the configuration example file example/DLBC.pipeline.yaml

        ---
        pipeline:
          flags:
            aligners:
              run_star: True
            quantifiers:
              run_featurecounts: True
              run_rsem: False
              run_kallisto: False
            callers:
              run_edger: True
              run_deseq2: True
              run_limma: True
          software:
            main:
              use_module: 0
              adapter_pe: AGATCGGAAGAGCGGTTCAG,AGATCGGAAGAGCGTCGTGT
              adapter_se: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
              fastq_format: 33
              genome_assembly: grch38

        When running on another data set, you need to modify these two file accordingly.

Pipeline Steps | Top

Step 1: Quality Control | Top

For the first step, the pipeline will perform quality assessment on the raw fastq files.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.RawReadQC.FastQC.SRR1205282.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/RawReadQC/KO01/SRR1205282/KO01.test_fastqc.zip' ] <- [ '/group/bioinformatics/CRI_RNAseq_2018/example/data/KO01.test.fastq.gz' ], cpus := 1, mem := 16*G, timeout := 72*hour, taskName := "FastQC.SRR1205282") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.RawReadQC.FastQC.SRR1205282.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/RawReadQC/KO01/SRR1205282/KO01.test_fastqc.zip' ] )

This code chunk will invoke the bash script example/DLBC/RNAseq/shell_scripts/run.RawReadQC.FastQC.SRR1205282.sh to execute FastQC on the KO01(SRR1205282) sequencing library.

After the completion of entire pipeline, you can check FastQC report per individual libraries; for instance, the partial report of KO01 will be as follows or a full report.

KO01_FastQC

You can check FastQC Help for more details about how to interpret a FastQC report.

Or, compare your reports to the example reports provided by FastQC for a Good Illumina Data or Bad Illumina Data.

Step 2.1: Read Alignment | Top

In this step, the pipeline will conduct read alignment on the raw fastq files.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.alignRead.star.SRR1205282.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/SRR1205282/SRR1205282.star.bam' ] <- [ '/group/bioinformatics/CRI_RNAseq_2018/example/data/KO01.test.fastq.gz' ], cpus := 4, mem := 64*G, timeout := 72*hour, taskName := "star.SRR1205282") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.alignRead.star.SRR1205282.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/SRR1205282/SRR1205282.star.bam' ] )

This code chunk will invoke the bash script example/DLBC/RNAseq/shell_scripts/run.alignRead.star.SRR1205282.sh to execute STAR on the KO01(SRR1205282) sequencing library.

After the completion of entire pipeline, you can check the alignment result of each individual libraries; for instance, the result of KO01(SRR1205282) will be as follows.

$ tree example/DLBC/RNAseq/Aln/star/KO01/SRR1205282
example/DLBC/RNAseq/Aln/star/KO01/SRR1205282
|-- SRR1205282.star.Aligned.sortedByCoord.out.bam
|-- SRR1205282.star.Log.final.out
|-- SRR1205282.star.Log.out
|-- SRR1205282.star.Log.progress.out
|-- SRR1205282.star.SJ.out.tab
|-- SRR1205282.star.Unmapped.out.mate1
|-- SRR1205282.star.bai
|-- SRR1205282.star.bam -> SRR1205282.star.Aligned.sortedByCoord.out.bam
`-- run.alignRead.star.SRR1205282.log

You can check a log file (e.g., example/DLBC/RNAseq/Aln/star/KO01/SRR1205282/SRR1205282.star.Log.final.out) for more alignment information provided by STAR.

$ cat example/DLBC/RNAseq/Aln/star/KO01/SRR1205282/SRR1205282.star.Log.final.out
                                 Started job on |   Jul 25 13:38:32
                             Started mapping on |   Jul 25 13:38:59
                                    Finished on |   Jul 25 13:39:03
       Mapping speed, Million of reads per hour |   215.88

                          Number of input reads |   239866
                      Average input read length |   49
                                    UNIQUE READS:
                   Uniquely mapped reads number |   238305
                        Uniquely mapped reads % |   99.35%
                          Average mapped length |   48.84
                       Number of splices: Total |   43900
            Number of splices: Annotated (sjdb) |   43566
                       Number of splices: GT/AG |   43729
                       Number of splices: GC/AG |   171
                       Number of splices: AT/AC |   0
               Number of splices: Non-canonical |   0
                      Mismatch rate per base, % |   0.22%
                         Deletion rate per base |   0.01%
                        Deletion average length |   1.98
                        Insertion rate per base |   0.00%
                       Insertion average length |   1.37
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |   0
             % of reads mapped to multiple loci |   0.00%
        Number of reads mapped to too many loci |   1552
             % of reads mapped to too many loci |   0.65%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |   0.00%
                 % of reads unmapped: too short |   0.00%
                     % of reads unmapped: other |   0.00%
                                  CHIMERIC READS:
                       Number of chimeric reads |   0
                            % of chimeric reads |   0.00%

Step 2.2: Alignment QC | Top

In this step, the pipeline will conduct a QC on alignment result.

The BDS code snippets for the sample KO01 will look like:

$ grep -A1 run.alnQC.*.star.KO01.*.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics.pdf' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bai' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "picard.star.KO01") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.alnQC.picard.star.KO01.CollectRnaSeqMetrics.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics.pdf' ] )
--
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.r', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.pdf' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bai' ], cpus := 1, mem := 8*G, timeout := 72*hour, taskName := "rseqc.star.KO01") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.alnQC.rseqc.star.KO01.clipping_profile.py.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.r', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.clipping_profile.pdf' ] )
--
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.infer_experiment.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bai' ], cpus := 1, mem := 8*G, timeout := 72*hour, taskName := "rseqc.star.KO01") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.alnQC.rseqc.star.KO01.infer_experiment.py.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.infer_experiment.txt' ] )
--
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.eRPKM.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.rawCount.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.saturation.r' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bai' ], cpus := 1, mem := 8*G, timeout := 72*hour, taskName := "rseqc.star.KO01") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.alnQC.rseqc.star.KO01.RPKM_saturation.py.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.eRPKM.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.rawCount.xls', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.saturation.r' ] )

This code chunk will invoke few bash scripts (e.g., example/DLBC/RNAseq/shell_scripts/run.alnQC.picard.star.KO01.CollectRnaSeqMetrics.sh, run.alnQC.rseqc.star.KO01.clipping_profile.py.sh, run.alnQC.rseqc.star.KO01.infer_experiment.py.sh, and run.alnQC.rseqc.star.KO01.RPKM_saturation.py.sh) to execute alignment QC tools (i.e., Picard and RSeQC) on the sample KO01.

After the completion of entire pipeline, you can check the alignment QC results of each individual samples; for instance, the results of KO01 will be as follows.

$ ls example/DLBC/RNAseq/AlnQC/*/star/KO01
example/DLBC/RNAseq/AlnQC/picard/star/KO01:
KO01.star.picard.RNA_Metrics  KO01.star.picard.RNA_Metrics.pdf  run.alnQC.picard.star.KO01.CollectRnaSeqMetrics.log  tmp

example/DLBC/RNAseq/AlnQC/rseqc/star/KO01:
KO01.star.pdfseqc.saturation.pdf      KO01.star.rseqc.eRPKM.xls             run.alnQC.rseqc.star.KO01.RPKM_saturation.py.log
KO01.star.rseqc.clipping_profile.pdf  KO01.star.rseqc.infer_experiment.txt  run.alnQC.rseqc.star.KO01.clipping_profile.py.log
KO01.star.rseqc.clipping_profile.r    KO01.star.rseqc.rawCount.xls          tmp
KO01.star.rseqc.clipping_profile.xls  KO01.star.rseqc.saturation.r

You can check alignment statistics (e.g., example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics) for more information provided by Picard.

$ head example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics
## htsjdk.samtools.metrics.StringHeader
# picard.analysis.CollectRnaSeqMetrics REF_FLAT=/group/bioinformatics/CRI_RNAseq_2018/example/reference/GRCh38.primary_Gencode24_50bp_chr11/gencode.v24.primary_assembly.annotation.chr11.refFlat.txt RIBOSOMAL_INTERVALS=/group/bioinformatics/CRI_RNAseq_2018/example/reference/GRCh38.primary_Gencode24_50bp_chr11/gencode.v24.primary_assembly.annotation.chr11.rRNA.interval_list STRAND_SPECIFICITY=NONE CHART_OUTPUT=/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics.pdf METRIC_ACCUMULATION_LEVEL=[SAMPLE, ALL_READS] INPUT=/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bam OUTPUT=/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/KO01.star.picard.RNA_Metrics TMP_DIR=[/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/AlnQC/picard/star/KO01/tmp]    MINIMUM_LENGTH=500 RRNA_FRAGMENT_PERCENTAGE=0.8 ASSUME_SORTED=true STOP_AFTER=0 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json
## htsjdk.samtools.metrics.StringHeader
# Started on: Wed Jul 25 13:41:44 CDT 2018

## METRICS CLASS    picard.analysis.RnaSeqMetrics
PF_BASES    PF_ALIGNED_BASES    RIBOSOMAL_BASES CODING_BASES    UTR_BASES   INTRONIC_BASES  INTERGENIC_BASES    IGNORED_READS   CORRECT_STRAND_READS    INCORRECT_STRAND_READS  PCT_RIBOSOMAL_BASES PCT_CODING_BASES    PCT_UTR_BASES   PCT_INTRONIC_BASES  PCT_INTERGENIC_BASES    PCT_MRNA_BASES  PCT_USABLE_BASES    PCT_CORRECT_STRAND_READS    MEDIAN_CV_COVERAGE  MEDIAN_5PRIME_BIAS  MEDIAN_3PRIME_BIAS  MEDIAN_5PRIME_TO_3PRIME_BIAS    SAMPLE  LIBRARY READ_GROUP
11676945    11638066    0   6586023 4106888 849952  95203   0   0   0   0   0.565904    0.352884    0.073032    0.008180.918788 0.915728    0   0.522396    0.602183    0.758017    0.701572
11676945    11638066    0   6586023 4106888 849952  95203   0   0   0   0   0.565904    0.352884    0.073032    0.008180.918788 0.915728    0   0.522396    0.602183    0.758017    0.701572    unknown

Or, the resepctive coverage plot of the sample KO01 produced by Picard will be as follows.

KO01_coverage

There are three alignment measurements performed using RSeQC.

  1. clipping_profile.py
    • Calculate the distributions of clipped nucleotides across reads
  2. infer_experiment.py
    • Use to “guess” how RNA-seq sequencing were configured, particulary how reads were stranded for strand-specific RNA-seq data, through comparing the “strandness of reads” with the “standness of transcripts”.
  3. RPKM_saturation.py
    • Calculate RPKM value using a series of resampled subsets from total RNA reads to check if the current sequencing depth was saturated or not (or if the RPKM values were stable or not) in terms of genes’ expression estimation

The results will be as follows. Please check the RSeQC web site for more measurements and details.

KO01_clipping_profile

$cat example/DLBC/RNAseq/AlnQC/rseqc/star/KO01/KO01.star.rseqc.infer_experiment.txt
## 
## 
## This is SingleEnd Data
## Fraction of reads failed to determine: 0.0025
## Fraction of reads explained by "++,--": 0.6025
## Fraction of reads explained by "+-,-+": 0.3950

KO01_saturation

Step 3: Expression Quantification | Top

In this step, the pipeline will conduct expression quantification over alignments.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.quant.featurecounts.star.KO01.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bai' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "featurecounts.star.KO01") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.quant.featurecounts.star.KO01.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count' ] )

This code chunk will invoke the bash script (e.g., example/DLBC/RNAseq/shell_scripts/run.quant.featurecounts.star.KO01.sh) to execute expression quantification tool (i.e., Subread::featureCounts on the sample KO01.

After the completion of entire pipeline, you can check the quantification results of each individual samples; for instance, the results of KO01 will be as follows.

$ tree example/DLBC/RNAseq/Quantification/featurecounts/star/KO01
example/DLBC/RNAseq/Quantification/featurecounts/star/KO01
|-- KO01.star.featurecounts.count
|-- KO01.star.featurecounts.count.jcounts
|-- KO01.star.featurecounts.count.summary
`-- run.quant.featurecounts.star.KO01.log

You can check quantification statistics (e.g., example/DLBC/RNAseq/Quantification/featurecounts/star/KO01KO01.star.featurecounts.count.summary) for more information provided by Subread::featureCounts

$ cat example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count.summary
Status  /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Aln/star/KO01/KO01.star.bam
Assigned    213869
Unassigned_Unmapped 0
Unassigned_MappingQuality   0
Unassigned_Chimera  0
Unassigned_FragmentLength   0
Unassigned_Duplicate    0
Unassigned_MultiMapping 0
Unassigned_Secondary    0
Unassigned_Nonjunction  0
Unassigned_NoFeatures   17539
Unassigned_Overlapping_Length   0
Unassigned_Ambiguity    6897

Or, the top 10 most abundant genes in the sample KO01 (on chr11) will be as follows.

$ cat <(head -n2 example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count | tail -n+2 | cut -f1,7) <(cut -f1,7 example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count | sort -k2,2nr | head)
Top 10 most abundant genes in KO01
Geneid Chr Start End Strand Length KO01
ENSG00000175216.14 chr11 46743048 46846229
8538 25908
ENSG00000149187.17 chr11 47465944 47565520
10441 17065
ENSG00000166181.12 chr11 43311963 43342676
4651 13992
ENSG00000149177.12 chr11 47980558 48170841
9620 13503
ENSG00000244313.3 chr11 46428653 46429150
498 10870
ENSG00000030066.13 chr11 47778087 47848467
8576 10493
ENSG00000165916.8 chr11 47418769 47426266
2276 9331
ENSG00000149084.11 chr11 43556436 43856610
8600 9247
ENSG00000109919.9 chr11 47617315 47642595
2897 8005
ENSG00000109920.12 chr11 47716517 47767301
7596 7883

Step 4-1: Identify Differentially Expressed Genes (DEGs) | Top

In this step, the pipeline will identify differentially expressed genes (DEG) according to the alignment result files (i.e., BAM files) after the alignment step.

The BDS code snippets for the example dataset will look like:

$ grep -A1 run.call.*.featurecounts.star.DLBC.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/edger/featurecounts/star/DLBC.star.featurecounts.edger.count.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO02/KO02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO03/KO03.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT01/WT01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT02/WT02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT03/WT03.star.featurecounts.count' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "edger.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.call.edger.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/edger/featurecounts/star/DLBC.star.featurecounts.edger.count.txt' ] )
--
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.count.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO02/KO02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO03/KO03.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT01/WT01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT02/WT02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT03/WT03.star.featurecounts.count' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "deseq2.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.call.deseq2.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.count.txt' ] )
--
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/limma/featurecounts/star/DLBC.star.featurecounts.limma.count.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO01/KO01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO02/KO02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/KO03/KO03.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT01/WT01.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT02/WT02.star.featurecounts.count', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/Quantification/featurecounts/star/WT03/WT03.star.featurecounts.count' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "limma.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.call.limma.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/DEG/limma/featurecounts/star/DLBC.star.featurecounts.limma.count.txt' ] )

This code chunk will invoke few bash scripts (e.g., example/DLBC/RNAseq/shell_scripts/run.call.edger.featurecounts.star.DLBC.sh, run.call.deseq2.featurecounts.star.DLBC.sh, and run.call.limma.featurecounts.star.DLBC.sh) to execute differential expression (DE) analysis using three the state-of-the-art tools (i.e., edgeR, DESeq2, and limma) on the example dataset of six samples from KO01 to WT03.

There are three DE analysis tools used in the current pipeline, including

  1. edgeR: Empirical Analysis of Digital Gene Expression Data in R
  2. DESeq2: Differential gene expression analysis based on the negative binomial distribution
  3. limma: Linear Models for Microarray Data

After the completion of entire pipeline, you can check the calling results of each individual methods; for instance, the analysis results of example dataset will be as follows.

$ ls example/DLBC/RNAseq/DEG/*/featurecounts/star/
example/DLBC/RNAseq/DEG/deseq2/featurecounts/star/:
DLBC.star.featurecounts.deseq2.RData
DLBC.star.featurecounts.deseq2.count.ntd.meanSdPlot.pdf
DLBC.star.featurecounts.deseq2.count.ntd.txt
DLBC.star.featurecounts.deseq2.count.rld.meanSdPlot.pdf
DLBC.star.featurecounts.deseq2.count.rld.txt
DLBC.star.featurecounts.deseq2.count.txt
DLBC.star.featurecounts.deseq2.count.vst.meanSdPlot.pdf
DLBC.star.featurecounts.deseq2.count.vst.txt
DLBC.star.featurecounts.deseq2.plotDispEsts.pdf
DLBC.star.featurecounts.deseq2.plotMA.pdf
DLBC.star.featurecounts.deseq2.test.DEG.txt
DLBC.star.featurecounts.deseq2.test.txt
run.call.deseq2.featurecounts.star.DLBC.log

example/DLBC/RNAseq/DEG/edger/featurecounts/star/:
DLBC.star.featurecounts.edger.RData        DLBC.star.featurecounts.edger.plotSmear.pdf
DLBC.star.featurecounts.edger.count.txt    DLBC.star.featurecounts.edger.test.DEG.txt
DLBC.star.featurecounts.edger.plotBCV.pdf  DLBC.star.featurecounts.edger.test.txt
DLBC.star.featurecounts.edger.plotMA.pdf   run.call.edger.featurecounts.star.DLBC.log

example/DLBC/RNAseq/DEG/limma/featurecounts/star/:
DLBC.star.featurecounts.limma.RData
DLBC.star.featurecounts.limma.count.voom.meanSdPlot.pdf
DLBC.star.featurecounts.limma.count.txt
DLBC.star.featurecounts.limma.plotMA.pdf
DLBC.star.featurecounts.limma.test.DEG.txt
DLBC.star.featurecounts.limma.test.txt
DLBC.star.featurecounts.limma.voom.mean-variance.pdf
run.call.limma.featurecounts.star.DLBC.log

You can check statistical test results per gene (e.g., example/DLBC/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.test.txt) for more information generated by each meathods.

$ head example/DLBC/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.test.txt
Statistical test result per gene using DESeq2
Geneid baseMean log2FoldChange lfcSE stat pvalue FDR DEG
4249 ENSG00000120738.7 5193.2844 1.960273 0.1147988 17.07573 0 0 1
9872 ENSG00000170345.9 422.7627 1.960006 0.1246756 15.72085 0 0 1
4273 ENSG00000113070.7 1441.0826 1.386086 0.1041939 13.30296 0 0 1
9601 ENSG00000100867.14 356.3080 1.707939 0.1339178 12.75364 0 0 1
8830 ENSG00000229117.8 7121.3363 -1.270634 0.1061629 -11.96871 0 0 -1
7342 ENSG00000035403.17 855.0647 -1.158327 0.1024376 -11.30764 0 0 -1
587 ENSG00000177606.6 556.6779 1.267243 0.1122316 11.29133 0 0 1
4407 ENSG00000038274.16 3176.8050 -1.277175 0.1135558 -11.24711 0 0 -1
7462 ENSG00000099194.5 27347.1594 -1.157671 0.1036467 -11.16940 0 0 -1
734 ENSG00000134215.15 2470.3706 1.200234 0.1078677 11.12691 0 0 1

Or, the exploratory plots of the example dataset produced by DESeq2 will be as follows.

  1. An exploratory plot of the per-gene dispersion estimates together with the fitted mean-dispersion relationship
    • KO01_DispEsts
  2. An exploratory plot of row standard deviations versus row means using the normalized counts transformation (f(count + pc))
    • KO01_ntd_meanSd
  3. An exploratory plot of row standard deviations versus row means using the variance stabilizing transformation
    • KO01_rld_meanSd
  4. An exploratory plot of row standard deviations versus row means using the ‘regularized log’ transformation
    • KO01_vst_meanSd
  5. A MA plot of log2 fold changes (on the y-axis) versus the mean of normalized counts (on the x-axis)
    • KO01_plotMA
  6. A scatter plot of log2 fold changes (on the y-axis) versus the FDR (on the x-axis)
    • KO01_plotMA

RUN AS PRACTICE

To demostrate the full power of the following analyses, the pipeline will use the pre-run count tables and DEG lists from the full sequencing data sets. Please make sure that there is no any changes on the meta data file (i.e., example/DLBC/DLBC.metadata.txt). Otherwise, it will be considered as not running for practice and should expect the following results not be the same as shown here.

Step 4-2: DEG Statistics | Top

In this step, the pipeline will collect DEG statistics and identify the overlapping set of identified DEGs from the previous methods.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.lociStat.featurecounts.star.DLBC.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/DLBC.star.featurecounts.overlap.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC_full/RNAseq/DEG/edger/featurecounts/star/DLBC.star.featurecounts.edger.test.DEG.txt', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC_full/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.test.DEG.txt', '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC_full/RNAseq/DEG/limma/featurecounts/star/DLBC.star.featurecounts.limma.test.DEG.txt' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "lociStat.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.lociStat.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/DLBC.star.featurecounts.overlap.txt' ] )

This code chunk will invoke the bash script (e.g., example/DLBC/RNAseq/shell_scripts/run.lociStat.featurecounts.star.DLBC.sh) to collect DEG statistics and to make a Venn diagram plot.

After the completion of entire pipeline, you can check the statistics result of DEGs per method; for instance, the example data set DLBC will be as follows.

$ grep -A5 'Up/Down regulated DEGs per methods' example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/run.lociStat.featurecounts.star.DLBC.log | tail -n+2
INFO [2018-07-25 15:18:08] #STAT:    Up/Down regulated DEGs per methods
    edger deseq2 limma
-1    484    409   408
0       0      0     0
1     387    362   395
Sum   871    771   803
$ cut -f1,2,4 example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/DLBC.star.featurecounts.VennList.txt
DEG Statistics
Methods Method.Num ID.Num
edger 1 40
deseq2 1 14
limma 1 45
edger&deseq2 2 85
edger&limma 2 86
deseq2&limma 2 12
edger&deseq2&limma 3 660

There is a Venn diagram plot will be generated after this step.

DLBC_full_Venn

Step 5: Sample Correlation | Top

In this step, the pipeline will make a PCA plot based on the transcriptional profiling of all samples.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.quantQC.pca.featurecounts.star.DLBC.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/QuantQC/featurecounts/star/DLBC.star.featurecounts.pca.pdf' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC_full/RNAseq/DEG/deseq2/featurecounts/star/DLBC.star.featurecounts.deseq2.count.txt' ], cpus := 4, mem := 32*G, timeout := 72*hour, taskName := "pca.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.quantQC.pca.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/QuantQC/featurecounts/star/DLBC.star.featurecounts.pca.pdf' ] )

This code chunk will invoke the bash script (e.g., example/DLBC/RNAseq/shell_scripts/run.quantQC.pca.featurecounts.star.DLBC.sh) to make a PCA plot based on the alignment quantification result generated by DESeq2 or one of DE analysis tools.

After the completion of entire pipeline, you can check the PCA plot under the folder of QuantQC/.

DLBC_full_Venn

Step 6: Heat Map | Top

In this step, the pipeline will make a heat map based on the overlapping set of DEGs identified across differenet DE analysis tools.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.postAna.pheatmap.featurecounts.star.DLBC.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/PostAna/pheatmap/featurecounts/star/DLBC/DLBC.star.featurecounts.heatmap.pdf' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/DLBC.star.featurecounts.overlap.txt' ], cpus := 1, mem := 8*G, timeout := 72*hour, taskName := "postAna.pheatmap.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.postAna.pheatmap.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/PostAna/pheatmap/featurecounts/star/DLBC/DLBC.star.featurecounts.heatmap.pdf' ] )

This code chunk will invoke the bash script (e.g., example/DLBC/RNAseq/shell_scripts/run.postAna.pheatmap.featurecounts.star.DLBC.sh) to make a heat map plot based on the overlapping set of DEGs identified across differenet DE analysis tools (i.e., edgeR, DESeq2, and limma).

After the completion of entire pipeline, you can check the heat map under the folder of PostAna/pheatmap.

DLBC_full_Venn

Step 7: Functional Enrichment Analysis | Top

In this step, the pipeline will conduct enrichment analysis and make several exploratory plots based on the overlapping set of DEGs identified across differenet DE analysis tools.

The BDS code snippet for the sample KO01 will look like:

$ grep -A1 run.postAna.clusterprofiler.featurecounts.star.DLBC.sh example/DLBC/Submit_RNAseq.DLBC.bds
dep( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/PostAna/clusterprofiler/featurecounts/star/DLBC/DLBC.star.featurecounts.enrichGO.ALL.txt' ] <- [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/LociStat/featurecounts/star/DLBC/DLBC.star.featurecounts.overlap.txt' ], cpus := 1, mem := 8*G, timeout := 72*hour, taskName := "postAna.clusterprofiler.featurecounts.star.DLBC") sys bash /home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/shell_scripts/run.postAna.clusterprofiler.featurecounts.star.DLBC.sh; sleep 2
goal( [ '/home/USER/cri_rnaseq/cri_rnaseq_2018/example/DLBC/RNAseq/PostAna/clusterprofiler/featurecounts/star/DLBC/DLBC.star.featurecounts.enrichGO.ALL.txt' ] )

This code chunk will invoke the bash script (e.g., example/DLBC/RNAseq/shell_scripts/run.postAna.clusterprofiler.featurecounts.star.DLBC.shh) to conduct enrichment analyses including GO and KEGG pathway erichment analyses as well as gene set enrichment analysis (GSEA).

After the completion of entire pipeline, you can check the heat map under the folder of PostAna/pheatmap.

$ ls example/DLBC/RNAseq/PostAna/clusterprofiler/featurecounts/star/DLBC/
DLBC.star.featurecounts.enrichGO.ALL.cnetplot.pdf    DLBC.star.featurecounts.enrichGSEAGO.ALL.neg001.pdf  DLBC.star.featurecounts.enrichKEGG.cnetplot.pdf
DLBC.star.featurecounts.enrichGO.ALL.dotplot.pdf     DLBC.star.featurecounts.enrichGSEAGO.ALL.pos001.pdf  DLBC.star.featurecounts.enrichKEGG.dotplot.pdf
DLBC.star.featurecounts.enrichGO.ALL.emapplot.pdf    DLBC.star.featurecounts.enrichGSEAGO.ALL.txt         DLBC.star.featurecounts.enrichKEGG.emapplot.pdf
DLBC.star.featurecounts.enrichGO.ALL.txt             DLBC.star.featurecounts.enrichGSEAKEGG.pos001.pdf    DLBC.star.featurecounts.enrichKEGG.txt      run.GSEA.featurecounts.star.DLBC.log

Below, several plots will be generated based on the overlapping set of DEGs using GO database as example.

  1. An exploratory dot plot for enrichment result
    • DLBC_full_enrichGO.ALL.dotplot
  2. An exploratory enrichment map for enrichment result of over-representation test
    • DLBC_full_enrichGO.ALL.emapplot
  3. An exploratory Gene-Concept Network plot of over-representation test
    • DLBC_full_enrichGO.ALL.cnetplot
  4. An exploratory plot of GSEA result with NES great than zero
    • DLBC_full_enrichGSEAGO.ALL.pos001
  5. An exploratory plot of GSEA result with NES less than zero
    • DLBC_full_enrichGSEAGO.ALL.neg001

BigDataScript Report | Top

Considering the environment setting in the CRI HPC system, BigDataScript was used as a job management system in the current development to achieve an automatic pipeline. It can handle the execution dependency of all sub-task bash scripts and resume from a failed point, if any.

After the completion of entire pipeline, you will see a BigDataScript report in HTML under the pipeline folder. For instance, this is the report from one test run. The graphic time line will tell you the execution time per sub-task script.

Submit.RNAseq.DLBC.bds

Reference | Top

TBC